intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

Have you joined pillowfort? Why or why not?

lavender-sprinkles:

I personally don’t have a Pillowfort account yet, but my partner does and she has let me look at her account fully to see what it is like. I’ve also viewed Pillowfort’s demo account which is linked to on their Kickstarter. I am waiting with anticipation when I can make my own account, but right now Pillowfort is in a closed beta which means the only people who have access to the site are ones who have been given special registration links. They were doing waves of free beta accounts a bit ago (which is how my partner got her account), but right now for every $5 you pledge to their Kickstarter you will receive a registration key if the Kickstarter gets fully funded (they are as of today 40% of the way to their $39,900 goal).

Here is why I’m excited for Pillowfort:

  • If you delete your original posts, every reblogged version will be deleted tooEdit your original post and the changes will appear on every reblog,
  • The ability to make posts visible to everyone, just followers, just mutuals, or just yourself.
  • A functional blacklist where you can blacklist a post body & tags or just tags.
  • A terms of service that explicitly states you hold all rights to your own intellectual property. It also states clearly that it forbids callout posts, doxxing, degradation, harassing, hate groups, spamming of tags with unrelated or offensive material, and slurs against minorities. If there is a user that is doing anything offensive or hateful, it is encouraged and mandated you don’t make posts about it and instead flag it and let the site moderators take care of it. This sort of system cuts down on “dashboard drama” and harassment that sites like Tumblr are known for. 
  • They have threaded comments which means discussions or praise no longer clog up your posts and your blog, keeping things much more organized and clean. We can also use tags for their ACTUAL purpose, tagging of posts for ease of search and organization instead of talking.
  • They have communities and a more connected user-based and user-led environment.
  • Posts in chronological order like they should be!
  • A staff that actually cares about the input of their members and is driven to listen and collaborate with their members to create a site that the users actually want instead of being led by a corporation that has their own agendas in mind.
  • A staff that wants to avoid corporate involvement, unwanted ads, and selling of user info to fund Pillowfort.
  • The future possibilities of what the staff can do with the site that we didn’t dream could be possible to have all in one place including accessibility and a functional mobile app.

So far, I’ve seen a lot of good things and I’ve been really impressed with how the staff is handling the site and how they have explained their plans for the future of Pillowfort.

If you say you really want a social media site that actually cares about their users, this is it. This is your chance to have what pretty much all of us want. This new blogging platform is all the best parts of Tumblr (and for those who miss Livejournal this is like a wedding between Tumblr and Livejournal) with all the parts we hate and loathe about the site scraped out of it.

If you like everything that you’ve read about Pillowfort.io, please pledge to their Kickstarter. Even $5 can help and it will get you a registration link to get on Pillowfort yourself if the Kickstarter gets fully funded.

If you can’t support Pillowfort monetarily, then please, please reblog, tweet, share, and spread it about everywhere you can. 

This is our chance to have a social media made with us in mind and it’s already starting out so well with 10,000 users in the closed beta. Let’s bring it to the next stage of its life!